DNA of Sculpture and Installation

Nela Ochoa's more than twenty-year career includes dance, performance, video, painting, sculpture, and installation. Since 1994 the artist has worked with DNA in her art, producing an innovative body of sculpture and installations that represents genetic sequences and gene mutations in living organisms. For her first exhibition in a botanical garden, Ochoa has created a sculpture and two ephemeral installations, each of which expresses the molecular sequence of a piece of DNA from an endangered species: the Buccaneer Palm, the Bermudana Fan Palm, and the Pawpaw. Although many contemporary artists draw on molecular genetics as a source of imagery and ideas for art, few have made endangered species or loss of habitat a core subject in their work.[1] Ochoa's exhibition in the Miami Botanical Gardens is intended to raise our awareness, through aesthetic configurations, of the dangers posed by the ecological extinction of botanical species in our environment.

For inspiration Ochoa draws directly on the double helix structure of specific DNA sequences of the plants she represents. DNA, which carries the genetic information of an organism, is mostly contained within each cell in a compartment known as the nucleus. DNA molecules are made up of building blocks called nucleotides, which are of four types: A, T, C, and G (adenine, thymine, cytosine, and guanine). They pair with each other on opposite strands of the DNA double helix: A with T and C with G. Genes, which determine all the heredity information, are made up of specific sequences of nucleotides.

In conceptualizing the form, composition, and colors of the sculptural projects, the artist follows the exact genetic sequences of the nucleotides of a specific gene in the actual plants. For example, the sequence of part of a particular gene of the Buccaneer Palm is:

gaaagctcgactttgatgcttatgttggtatgtcaattggtgttgatcgctgaacatagtaatagactt taatatcttgcaaatgcatcatgaaaaaaaaaaaaaatgacataccaaacaaatcatctgatcaattttgtttg gtacctttttctaagagaaagattggaggagcccacctgattaattgagataatgagactggtagatatgt tgagtctcatgttcttcagatatcagattatccatctttcttwagcactcttggattactgacagcttgtagcttg gtgcccctggcagacctacagaagcagtatgctgatgccgtaatcgaagttttacctacacaattagttcct gatgaccatgaaaggaaggtgctgagagttcgattggtgatgaaagaaggggtgaagtacttcaatccagtt

A similar example for the Bermudana Fan Palm is:

aaaatccgtcgactttagaaatcgtgagggttcaagtccctctatcccca

And for the Pawpaw is:

acgtaatgctcacaacttccctctagacctagctgctgtagaagtcccatctacaaatggataatacttcagccttagt gttagtgtatatgagttgatgaaggatcagatcaatgccaacttattccatcaaatcaataagttggcattgatct gtttgattcagtagtctttataatcacataagcattttttctattttttttttcataaaacaaaaatagattatttctggcg

As noted, the genetic codes of the three plants represent parts of different genes, thus requiring distinctive aesthetic configurations. Each artwork simulates the order of the nucleotides in their respective DNA sequences.As a result, Buccaneer Helix, an ephemeral installation made from 868 plastic baseball bats, forms a double helix stretching some fifty-three feet along the ground. Each of the 434 units is constructed by removing the handles so that one bat can fit into the other. The bats are covered with Lycra sleeves in turquoise, black, fuchsia, and cobalt blue—each color symbolizing one of the nucleotides in the sequence. Royal blue stands for A, black for T, turquoise for C, and fuchsia for G. In simulating genetic pairing, the A and T appear 267 times, and the C and G, 167 times.

Bermudana Helix, an eight-foot-high sculpture, also forms a double helix. The standing sculpture is constructed from fifty custom-made, wooden tubular units resembling bats, each side painted the color that corresponds to the letter it represents. In this work, the A is aqua, the T, lime green, the C, royal blue, and the G, khaki.

Pompom Pawpaw Patch, featuring some 478 pompoms, represents a single strand of the DNA sequence. The red, yellow, royal blue, and light blue pompoms are arranged in eight rows on the ground in an area approximately 25 feet long and l3 feet deep. The pompoms, which vary in height from 7 to 23 inches, create a colorful animation as they sway in the breeze.

Ochoa's embrace of certain post-minimalist principles—the repetition of colors, materials, geometric arrangements of forms, as well as transformations of everyday found objects—calls attention to the artifice employed in imaging DNA. The visually engaging three-dimensional work prompts the visitor in the garden to pause and consider the future of endangered species protected within its confines.

While scientists try to solve the mysteries encoded in our genes, artists attempt to incorporate genetic concepts into aesthetic works. Ochoa's art is a reference, not an empirical representation of plants in the Miami Botanical Gardens. We should be reminded that each species has a unique genetic code, and if the Buccaneer Palm, the Bermudana Fan Palm, or the Pawpaw become extinct, there will be no way to replace them—at least not at this time.

— Julia P. Herzberg

After seeing the sadly long list of endangered plants in Florida, I looked to see ifthere are any genes that have been sequenced from those plants. After researching the plants' scientific and common names, I select a gene from web pages such as those provided by the NCBI (National Center for Biotechnology Information), a gene database. The plant data that I collect then leads me along other paths, into other landscapes.

In rescuing the endangered "recipe" for the gene, I create another level of speech that goes beyond the gene and adds a human-cultural meaning to its chemical reality. As I knit the whole sequence together, the resulting artwork seems distant from its origins, but at the same time it remains intimately attached to them. The gene maintains its unique, rhythmical essence.

I like to work with ready-made materials that I can easily manipulate, especially for ephemeral installations, knowing that they can be repeated, serialized just as nature does with the genetic code.

— Nela Ochoa

“DNA of Sculpture and Installation” for Gene Garden was originally published in the exhibition brochure at the Miami Beach Botanical Gardens in Miami in 2008.
Fish Tail Palm 1, 2, 3 and Decoded Daisy (detail) © Nela Ochoa
Paw Paw Patch on cover and Buccaneer Helix © Mariano Costa Peuser
Images of the outdoors © Odalys Valdivieso
Artworks © Nela Ochoa

Artist website: https://www.nelaochoa.net/
@nelaochoa